2 Shaanxi Key Laboratory of Chinese Jujube (Yanan University), Yan’an, 71600, P.R. China
Author
Correspondence author
Medicinal Plant Research, 2020, Vol. 10, No. 5 doi: 10.5376/mpr.2020.10.0005
Received: 04 Jul., 2020 Accepted: 19 Jul., 2020 Published: 07 Aug., 2020
Wang R., Wu J.W., Chang H.X., Chen G.L., and Bai Z.Q., 2020, Cloning and bioinformatics analysis of SmTIR1 gene of Salvia miltiorrhiza, Medicinal Plant Research, 10(5): 1-8 (doi: 10.5376/mpr.2020.10.0005)
Auxin receptor plays a pivotal role in plant growth as regulated by auxin in plants. The growth of Salvia miltiorrhiza directly correlates with its quality. Nevertheless, to date gene of auxin receptor in S. miltiorrhiza is still unclear. In the present study, a gene with 1887 bp cDNA sequences was cloned in S. miltiorrhiza, and also performed bioinformatic analysis. This gene deploys the typical structure of auxin receptor TIR1, thus being named SmTIR1 here. By predicating its functions, SmTIR1 is a hydrophilic protein with the typical structure of TIR1. Those results lay a foundation for further study of auxin receptor in S. miltiorrhiza, and provides theories for plant growth and development of S. miltiorrhiza as well.
Salvia miltiorrhiza is a Chinese herbal medicine of Salvia Linn. Its medical functions involve in promoting blood circulation and removing blood stasis, relieving pain through channels, clearing heart and removing troubles, cooling blood and eliminating carbuncle. It has become one of the most important medicinal plants because of its significant therapeutic effect in modern medicine clinical treatment of coronary heart disease, cardiovascular and cerebrovascular diseases (Ma and Dong, 2014, Chinese pharmacy, 25(7): 663-665; Wan et al., 2020). lipophilic tanshinone and hydrophilic phenolic acid, which have the pharmacological effects of anti-tumor, prevention and treatment of cardiovascular disease, anti-inflammatory, anti-oxidation, radiosensitization and liver protection, are the main effective components of S. miltiorrhiza, (Li et al., 2009; Dong, 2015; Wan et al., 2020). The accumulation of active components of S. miltiorrhiza is closely related to its growth and development. In the process of plant growth and development, it will be affected by many factors, the external factors are mainly environmental factors, and the internal factors are mainly self-secreted hormones that affect the synthesis and accumulation of metabolites (Li, 2006, Northwest University of agriculture and forestry science and technology, pp.28-39; Bai, 2011, Henan Normal University, pp.25-31; Sheng and Chen, 2013; Liu, 2014, Northwest Agricultural and Forestry University of Science and Technology, pp.41-49; Ding et al., 2017; Xing et al., 2018; Zhang et al., 2019).
Plant hormones can affect the accumulation of plant metabolites. It has been found that abscisic acid, gibberellin, ethylene and other hormones and their interactions can effectively improve the accumulation of phenolic acids in hairy roots of S. miltiorrhiza (Liang et al., 2013). Among many plant hormones, auxin is an indispensable hormone in the process of plant growth, organ development (Ruegger et al., 1998), cell differentiation, etc., and the formation, synthesis, action and signal transduction of auxin have been hot discussed by researchers (Woodward and Bartel, 2005). Auxin mainly interacts with the corresponding receptors, thus mediating the downstream signaling pathway to cause the corresponding growth effect (Kepinski and Leyser, 2004; Winkler et al., 2017). At present, there are three known auxin receptors:ABP, SKP2A and TIR1/AFBs, which are combined with auxin to initiate the degradation of SCFTIR1/AFBs-Aux/ IAA ubiquitin proteasome (Salehin et al., 2015).
TIR1 receptor was first found in a Arabidopsis mutant, and its gene was isolated from it. Its product was transport inhibitor protein 1 (TIR1) (Kepinski and Leyser, 2005). TIR1 contains a characteristic domain F-box, which is a part of SCF complex. It can directly bind with Aux/IAA protein and mediate its degradation (Dharmasiri et al., 2005; Shu et al., 2015; Yu et al., 2015; Yamada et al., 2018). The protein encoded by Aux/IAA can pass through auxin response factors, ARFs) specifically bind to form SCFTIR1/AFBs-Aux/IAA complex, and then the Aux/IAA protein on the complex is ubiquitinated, which mediates the degradation of proteasome, and at the same time activates ARFs to make auxin induced gene expression, leading to auxin response (Gray et al., 2001; Parry et al., 2009; Salehin et al., 2015). As an important component of response to auxin reaction, there is no report about TIR1 gene in S. miltiorrhiza. Therefore, in this study, TIR1 gene of sesame indicum, a relative species of S. miltiorrhiza, was selected to compare with that of S. miltiorrhiza transcriptome measured in our laboratory by using bioedit software. The first ten sequences of similarity scores were screened, and then Seqman software was used for splicing to get a 2 563 bp sequence. Then ORF prediction was carried out, primers were designed for cloning, and finally a 1887 bp sequence was obtained, which was used for later TIR1 of S. miltiorrhiza. The bioinformatics analysis of SmTIR1 (named in this laboratory) will lay a foundation for the research of the related functions of the auxin receptor of S. miltiorrhiza and the breeding of its excellent germplasm resources.
1 Results and Analysis
1.1 Gene cloning and sequence analysis
SmTIR1 has a total length of 1 887 bp (Figure 1; Figure 2A), encoding 590 amino acids (Figure 1). The results of blastp showed that the similarity respectively are 92.54% between SmTIR1 and Salvia splendens (SsTIR1, tey30884.1), 87.56% between SmTIR1 and Sesame indicum (SiTIR1, XP 011096196.1), 86.54% between SmTIR1 and Erythrantha gutta (EgTIR1, XP 012849055.1), and 74.07% between SmTIR1 and Daucus Carota subsp. Sativus (DcssTIR1, The similarity of XP 017229520.1), 74.79% with Nicotiana tomentosiformis (NtTIR1, XP 00963009.1), 74.03% with Nicotiana sylvestris (NsTIR1, XP 009763253.1), 76.64% with Camellia sinensis (CsTIR1, XP 028113968.1).
![]() Figure 1 SmTIR1 gene sequence of S. miltiorrhiza |
![]() Figure 2 Prediction of CDS region and acquisition of gene SmTIR1 Note: A: Result of amplification; B: Prediction of CDS region of SmTIR1; C: Protein structure domain analysis |
Based on the conserved domains analysis of the SmTIR1, the results show that SmTIR1 contain the AMN1 superfamily domain at 135-260 and 316-511 respectively, and it is an antagonist of the MEN pathway (mitotic exit network) (Figure 2C). When the MEN pathway is activated, AMN1 binds with TEM1 (a GTPase) to suppress the MEN pathway and regulate the cell cycle. AMN1 is a leucine rich repeat (LRR) protein. The leucine rich repeat region collects targets by interacting with TIR1, which mainly affects mitosis. In addition, there is an F-box-5 between 26 and 66 bp. It is transp _ inhibit domain in 86-131bp. Using softberry to predict the CDs sequence of TIR1 gene, it was found that its CDs region was from 65 bp to 1837 bp (Figure 2B), and its upstream region with 2000bp predicted its upstream regulatory elements by PlantCARE. The results showed that in addition to the common cis acting elements CAAT-box and core promoter elements in the promoter and enhancer regions in TATA-box, there were also cis-regulatory elements related to meristem expression. In addition, there were gibberellin response elements P-box and GAT-box motif involved in ABSE reaction cis acting elements and some important components (Table 1).
![]() Table 1 The prediction of upstream promoter Note: Only the main |
1.2 Structure and property analysis of SmTIR1
SmTIR1 has 590 amino acid residues. Its molecular weight and isoelectric point are 66.609 63 kD and 6.08 respectively. The instability coefficient is 45.93, the aliphatic index is 87.73, and the average hydrophilic coefficient (gravy) is -0.172, so SmTIR1 might be hydrophilic, the arginine (Arg) score at 372 is the lowest (-3.200), and the hydrophilicity is the strongest; the glycine (Gly) score at 382 is the highest (1.778), and the hydrophobicity is the strongest. Using SOPMA to predict the secondary structure of amino acid sequence of SmTIR1, SmTIR1 contains 47.97% α helix, 35.76% random curl, 12.37% extension chain and 3.90% β corner (Figure 3C). Using NetPhos 3.1 Server to analyze phosphorylation sites, 35 serine sites, 14 threonine sites and 4 tyrosine sites were found (Figure 3B). Using SWISS-MODEL to search and construct the template, we predicted the three-level structure of the amino acid sequence of SmTIR1 (Figure 3A). The three-level structure of SmTIR1 mainly consists of F-box (dark blue area in the middle and lower part of Figure 3A) and LRR, and the similarity with TIR1 model of Arabidopsis (PDB: 3c6o. 1. B) is 54.64%. According to the analysis of SingalP 3.0 Server (Figure 3D) and THHMM 2.0 (Figure 3E), there is no signal peptide in TIR1 sequence, s value (s value of signal peptide region is higher): 0.202; C value (shear site, and one amino acid corresponds to one C value): 0.155; y value (comprehensive analysis of s value and C value to determine the value of shear site): 0.046, which is presumed to be non-secretory protein (D value: 0.027), and there is no transmembrane domain. The subcellular localization results of TargetP 1.1 and Plant-mPLoc (Table 2) show that the gene is predicted to be located in the nucleus.
![]() Figure 3 Structure and properties of SmTIR1 coding protein Note: A: 3D-structure of SmTIR1 coding protein; B: Prediction of protein phosphorylation sites; C: Secondary structure of SmTIR1 coding protein; Blue: Alpha helix; Green: Beta turn; Yellow: Random coil; Red: Extended strand; D: The prediction of signal peptide (Because the sequence is too long, the lower amino acid sequence is shown as black); E: The prediction of transmembrane region |
![]() |
1.3 Construction of system evolution tree of SmTIR1
Using the NJ method (bootstrap tests value is set to 1000) to predict and analyze the evolutionary relationship of SmTIR1 obtained by MEGA X (Figure 4). The results of the evolutionary tree showed that SmTIR1 is grouped with TIR1 of a string of Salvia splendens Ker-Gawler, Sesamum indicum and Erythranthe guttata and the genetic relationship is the most similar with Salvia splendens Ker-Gawler. It is suggested that SmTIR1 should have similar function with these TIR1 genes. The gene structure determines its functions, so there should be higher similarity in structure.
![]() Figure 4 The evolutionary analysis and relationship prediction of of gene SmTIR1 Note: SmTIR1: Salvia miltiorrhiza; SsTIR1: Salvia splendens; SiTIR1: Sesamum indicum; EgTIR1: Erythranthe guttata; NtTIR1: Nicotiana tomentosiformis; NsTIR1: Nicotiana sylvestris; DcssTIR1: Daucus carota subsp. sativus; CsTIR1: Camellia sinensis; The square area on the far right represents different domains and is distinguished by different colors |
2 Discussion
The medicinal value and yield of medicinal plants are affected by auxin regulation, auxin regulates the expression of corresponding genes through SCFTIR1/AFBs Aux/IAA-ARF signal pathway, and then regulates various growth processes. Therefore, it is necessary to analyze SmTIR1 to study the growth and development, increase the accumulation of effective components and the yield improvement of S. miltiorrhiza. Previous studies have found that the ORF of MaTIR1 is 1758 bp, encoding 585 amino acids, 65.4387 KD of protein molecular weight, and 6.31 of isoelectric point in Morus alba L. (Tang et al., 2014). The ORF of CsTIR1 is 1746 bp, encoding 581 amino acids, 65.18 KD of molecular weight, and 5.64 of theoretical isoelectric point (PI) in Camellia sinensis (L.) O. Ktze. (Cao et al., 2015). The ORF of DlTIR1-1 is 1755 bp, encoding 584 amino acids, which are hydrophilic proteins, theoretical isoelectric point is 6.27, the ORF of DlTIR1-2 is 1926 bp, encoding 641 amino acids, which are hydrophilic proteins, which are hydrophilic proteins with isoelectric point of 5.24 in Dimocarpus longan Lour. (Lai et al., 2016, Journal of Tropical Biology, 37(1): 136-143); the ORF of HcTIR1 is 1761 bp, encoding 586 amino acids in Hibiscus cannabinus (Chen et al., 2017). The physical and chemical properties of TIR1 in the above species are similar to those of SmTIR1. The properties of these proteins can affect folding, and the formation of protein high-level structure that it is also related to the properties of proteins, which may be closely related to the function and mode of action of TIR1.
Recently, scholars have found that the MaTIR1 may play an important role in the formation of adventitious roots in M. alba L. (Tang et al., 2014); the expression of CsTIR1 is closely related to dormancy in C. sinensis (L.) O. Ktze (Cao et al, 2015); DlTIR1-1 and DlTIR1-2 may participate in the root differentiation and flowering process of D. longan Lour (Lai et al., 2016, Journal of tropical crops, 37(1): 136-143); SlTIR1A affects the fruit setting process, while SlTIR1B affects the nutritional growth and fruit formation in Solanum lycopersicum (Lin, 2016, Chongqing University), The HcTIR1 gene expression may be related to male sterility in H. cannabinus (Chen et al., 2017). The SmTIR1 is similar to TIR1 gene in the above species in structure, especially with S. splendens Ker-Gawler, which has a typical highly conserved F-box domain and leucine repeat domain (LRR), and the structure and physical and chemical properties of the protein encoded by TIR1 gene are also similar. Thus, the SmTIR1 might be a potential auxin receptor which can regulate the root development and growth of S. miltiorrhiza.
S. miltiorrhiza is a traditional medicinal medicine for the treatment of cardiovascular and cerebrovascular diseases in modern clinical medicine. Due to the limited planting land area, the limited output is difficult to meet the market demand, and the growth and development process affects the quality of S. miltiorrhiza (Zhou et al., 2012). In this study, SmTIR1, a potential auxin receptor in S. miltiorrhiza, was obtained, and its structure and function were predicted. The characteristics of SmTIR1 were preliminarily understood and predicted, which laid a foundation for exploring the function of auxin receptor in the growth and development of S. miltiorrhiza, and provided a new idea for the research of excellent germplasm resources selection of S. miltiorrhiza. In the future, plant gene editing and other technologies will be used to further confirm the function of SmTIR1, so as to lay the foundation for variety improvement of S. miltiorrhiza through genetic engineering strategy, and then achieve the goal of improving yield and quality to meet the market demand for S. miltiorrhiza.
3 Materials and Methods
3.1 Materials
S. miltiorrhiza leaves (seeds purchased from Hebei An guo Pharmaceutical Group Co., Ltd.); Tiangen polysaccharide polyphenol plant RNA Extraction Kit (purchased from Tiangen Biological Reagent Co., Ltd., cat.#DP441, Beijing, China); nanodrop one micro spectrophotometer; Takara reverse transcription Kit (Takara, Code No. RR047A, Beijing, China).
3.2 RNA extraction and cDNA synthesis
Take 100 g of S. miltiorrhiza leaves and put them into a mortar, grind them with liquid nitrogen, and then extract the total RNA of Salvia miltiorrhiza with RNA Extraction Kit (polysaccharide polyphenol) (Tiangen, cat.# DP441, Beijing, China). The RNA concentration was measured by nanodrop. The RNA was stored in - 80℃ refrigerator for downstream cDNA synthesis. The total RNA of Salvia miltiorrhiza was reverse transcribed by Takara (Code No. RR047A, Beijing, China), and the cDNA of Salvia miltiorrhiza was obtained.
3.3 Cloning of SmTIR1 gene
According to the obtained SmTIR1 gene fragment, PCR specific primers were designed and polyacrylamide gel electrophoresis (Figure 2A), SmTIR1-F: CTTGTTGAGGCCTAAATGAATCCATCC, SmTIR1-R: GGTTTTC CCTTCACTGTCAAACTG were used. The amplification conditions were: 95℃ for 5 min, (95℃ for 45 s, 58℃ for 45 s, 72℃ for 2 min), 35 cycles, 72℃ for 10 min, 4℃.
3.4 SmTIR1 bioinformatics analysis
Putting the full length sequence of cDNA in ORF finder of NCBI database (http://www.bioinformatics.org/ sms2/orf_find.html). The ORF of the sequence is analyzed in the softberry website (http://linux1.softberry.com/ berry.phtml) The HMM based gene structure prediction module in NCBI is used to predict the gene structure of the target gene, verify and obtain the corresponding amino acid sequence, and then use blast in NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi).Search for similar proteins, then use ClusterW (https://www.genome. jp/tools-bin/clustalw)The amino acid sequences were compared and the phylogenetic tree was constructed by MEGA X. The software bioedit was used to compare the genome of S. miltiorrhiza, search and obtain the gene sequence of 2 000 bp upstream of SmTIR1, and then use PlantCARE (http://bio informatics.psb.ugent.be/ webtools/plantcare/html) forecast the upstream control elements. Then, the amino acid sequence encoded by SmTIR1 was analyzed by CDD online analysis website, and the conserved domain was verified by Pfam and MEME online analysis website (https://web.expasy.org/compute_ Pi) was used to predict the physical and chemical properties of protein. Then TMHMM 2.0 and SignalP 3.0 server were used to predict and analyze transmembrane domain and signal pepdtie respectively. WOLFPSORT is used for subcellular location prediction analysis (https://wolfpsort. hgc.jp/) and TargetP 1.1 Server (http://www.cbs.dtu.dk/ services/ TargetP/), Plant-mPLoc and other online analysis websites. On line prediction and analysis of secondary structure is carried out by SOPMA website. The disulfide bond and phosphorylation sites were predicted respectively with NetPhos 3.1 Server and Disulfindis (http://disulfind.dsi.unifi.it/). The three-level structure model of the protein was searched and constructed by using the online website Swiss-Model, and the protein properties and hydrophobicity were predicted and analyzed by ProtParam and ProtScalein of the ExPASY website.
Author's contributions
Rui Wang and Huixuan Chang are the experimental designers and executors of this study, who complete the data analysis and the writing of the first draft of the thesis; Jiawen Wu and Guoliang Chen participate in the experimental design and the analysis of the experimental results; Zhenqing Bai is the conceiver and director of the project, who guides the experimental design, data analysis, and the writing and modification of the thesis. All the authors read and agreed to the final text.
Acknowledgements
This research is co-sponsored by the research project of Yan'an University (2003/205040217), the research project of Yan'an University (2003/205110027) and the research project of Yan'an University (YCX201928).
Cao H.L., Yue C., Zhou Y.H., Wang L., Hao X.Y., Zeng J.M., Yang Y.J., and Wang X.C., 2015, Cloning and expression analysis of auxin receptor gene CsTIR1 in tea plant (Camellia sinensis), Chaye Kexue (Journal of Tea Science), 35(1): 45-54
Chen L.H., Zhou B.J., and Zhou R.Y., 2017, Cloning of TIR1 gene in Hibiscus cannabinus L. and construction of its expression vector, Nanfang Nongye Xuebao (Journal of Southern Agriculture), 48(8): 1343-1350
Dharmasiri N., Dharmasiri S., and Estelle M., 2005, The F-box protein TIR1 is an auxin receptor, Nature, 435(7041): 441-445
https://doi.org/10.1038/nature03543
PMid:15917797
Ding K., Pei T.L., Bai Z.Q., Jia Y.Y., Ma P.D., and Liang Z.S., 2017, SmMYB36, a novel R2R3-MYB transcription factor, enhances tanshinone accumulation and decreases phenolic acid content in Salvia miltiorrhiza hairy roots, Sci. Rep., 7(1): 5104
https://doi.org/10.1038/s41598-017-04909-w
PMid:28698552 PMCid:PMC5506036
Dong F.C., 2015, Composition and pharmacological action of Salvia miltiorrhizas Bge., Zhongguo Yaowu Jingjixue (China Journal of Pharmaceutical Economics), 10(3): 99-100
Gray W.M., Kepinski S., Rouse D., Leyser O., and Estelle M., 2001, Auxin regulates SCFTIR1-dependent degradation of AUX/IAA proteins, Nature, 414(6861): 271-276
https://doi.org/10.1038/35104500
PMid:11713520
Kepinski S., and Leyser O., 2004, Auxin-induced SCFTIR1-Aux/IAA interaction involves stable modification of the SCFTIR1 complex, Proc. Natl. Acad. Sci. USA, 101(33): 12381-12386
https://doi.org/10.1073/pnas.0402868101
PMid:15295098 PMCid:PMC514484
Kepinski S., and Leyser O., 2005, The Arabidopsis F-box protein TIR1 is an auxin receptor, Nature, 435(7041): 446-451
https://doi.org/10.1038/nature03542
PMid:15917798
Li Y.G., Song L., Liu M., Hu Z.B., and Wang Z.T., 2009, Advancement in analysis of Salviae miltiorrhizae Radix et Rhizoma (Danshen), J. Chromatogr. A, 1216(11): 1941-1953
https://doi.org/10.1016/j.chroma.2008.12.032
PMid:19159889
Liang Z.S., Ma Y.N., Xu T., Cui B.M., Liu Y., Guo Z.X., and Yang D.F., 2013, Effects of abscisic acid, gibberellin, ethylene and their interactions on production of phenolic acids in Salvia miltiorrhiza Bunge hairy roots, PLoS One, 8(9): e72806
https://doi.org/10.1371/journal.pone.0072806
PMid:24023778 PMCid:PMC3759372
Parry G., Calderon-Villalobos L.I., Prigge M., Peret B., Dharmasiri S., Itoh H., Lechner E., Gray W.M., Bennett M., and Estelle M., 2009, Complex regulation of the TIR1/AFB family of auxin receptors, Proc. Natl. Acad. Sci. USA, 106(52): 22540-22545
https://doi.org/10.1073/pnas.0911967106
PMid:20018756 PMCid:PMC2799741
Ruegger M., Dewey E., Gray W.M., Hobbie L., Turner J., and Estelle M., 1998, The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p, Genes Dev., 12(2): 198-207
https://doi.org/10.1101/gad.12.2.198
PMid:9436980 PMCid:PMC316440
Salehin M., Bagchi R., and Estelle M., 2015, SCFTIR1/AFB-based auxin perception: mechanism and role in plant growth and development, Plant Cell, 27(1): 9-19
https://doi.org/10.1105/tpc.114.133744
PMid:25604443 PMCid:PMC4330579
Sheng D.F., and Chen L., 2013, Effects of PEG-6000 stress on tanshinones accumulation in hairy roots of Salvia miltiorrhiz, Zhongcaoyao (Chinese Traditional and Herbal Drugs), 44(9): 1181-1185
Shu W.B., Liu Y.L., Guo Y.H., Zhou H.J., Zhang J., Zhao S.T., and Lu M.Z., 2015, A Populus TIR1 gene family survey reveals differential expression patterns and responses to 1-naphthaleneacetic acid and stress treatments, Front. Plant Sci., 6: 719
https://doi.org/10.3389/fpls.2015.00719
PMid:26442033 PMCid:PMC4585115
Tang Z., Du W., Li X.Y., and Cheng J.L., Cloning and expression analysis of mulberry TIR1 gene in various organs and in rooting process of cuttings, Canye Kexue (Science of Sericulture), 40(5): 790-796
Wan X.H., Wang Y.L., Zhou C.Z., Guo H., Ma S., and Wang L.Z., 2020, Research progress on chemical constituents and pharmacological effects of Salvia miltiorrhiza, Zhongcaoyao (Chinese Traditional and Herbal Drugs), 51(3): 788-798
Winkler M., Niemeyer M., Hellmuth A., Janitza P., Christ G., Samodelov S.L., Wilde V., Majovsky P., Trujillo M., Zurbriggen M.D., Hoehenwarter W., Quint M., and Calderón Villalobos L.I.A., 2017, Variation in auxin sensing guides AUX/IAA transcriptional repressor ubiquitylation and destruction, Nat. Commun., 8: 15706
https://doi.org/10.1038/ncomms15706
PMid:28589936 PMCid:PMC5467235
Woodward A.W., and Bartel B., 2005, Auxin: regulation, action, and interaction, Ann. Bot., 95(5): 707-735
https://doi.org/10.1093/aob/mci083
PMid:15749753 PMCid:PMC4246732
Xing B.C., Liang L.J., Liu L., Hou Z.N., Yang D.F., Yan K.J., Zhang X.M., and Liang Z.S., 2018, Overexpression of SmbHLH148 induced biosynthesis of tanshinones as well as phenolic acids in Salvia miltiorrhiza hairy roots, Plant Cell Rep., 37(12): 1681-1692
https://doi.org/10.1007/s00299-018-2339-9
PMid:30229287
Yamada R., Murai K., Uchida N., Takahashi K., Iwasaki R., Tada Y., Kinoshita T., Itami K., Torii K.U., and Hagihara S., 2018, A super strong engineered auxin-TIR1 pair, Plant Cell Physiol., 59(8): 1538-1544
https://doi.org/10.1093/pcp/pcy127
PMid:29986114 PMCid:PMC6084576
Yu H., Zhang Y., Moss B.L., Bargmann B.O.R., Wang R.H., Prigge M., Nemhauser J.L., and Estelle M., 2015, Untethering the TIR1 auxin receptor from the SCF complex increases its stability and inhibits auxin response, Nat. Plants, 1(3): 14030
https://doi.org/10.1038/nplants.2014.30
PMid:26236497 PMCid:PMC4520256
Zhang C.L., Yang D.F., Liang Z.S., Liu J.L., Yan K.J., Zhu Y.H., and Yang S.S., 2019, Climatic factors control the geospatial distribution of active ingredients in Salvia miltiorrhiza Bunge in China, Sci. Rep., 9(1): 904
https://doi.org/10.1038/s41598-018-36729-x
PMid:30696840 PMCid:PMC6351527
Zhou L.L., Yi W.Z., Qi J.J., Sun P., and Li X.E., 2012, Effect of varieties and growth years on root yield and bioactive components accumulation dynamics of Salvia miltiorrhizae, Zhongguo Yesheng Zhiwu Ziyuan (Chinese Wild Plant Resources), 31(5): 8-11, 17
. PDF(2515KB)
. HTML
Associated material
. Readers' comments
Other articles by authors
. Rui Wang
. Jiawen Wu
. Huixuan Chang
. Guoliang Chen
. Zhenqing Bai
Related articles
. Salvia miltiorrhiza
. SmTIR1 gene
. Cloning
. Bioinformatics
Tools
. Email to a friend
. Post a comment
.png)
.png)
.png)
.png)
.png)
.png)